Stem-loop sequence hsa-mir-622

AccessionMI0003636 (change log)
Symbol HGNC:MIR622
DescriptionHomo sapiens miR-622 stem-loop
Gene family MIPF0000619; mir-622
Literature search

24 open access papers mention hsa-mir-622
(137 sentences)

Stem-loop
   -agagaag  -  aca   a  gg             a -  -  g   c 
5'         cu gg   agu cu  ucucagcagauug g ga ga cac a
           || ||   ||| ||  ||||||||||||| | || || |||  
3'         ga uc   ucg gg  ggagucgucugac c cu cu gug c
   ucacagua  g  --g   a  uu             a a  a  g   a 
Get sequence
Deep sequencing
134 reads, 5.08 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 90231182-90231277 [+]
intergenic
Database links

Mature sequence hsa-miR-622

Accession MIMAT0003291
Sequence

61 - 

acagucugcugagguuggagc

 - 81

Get sequence
Deep sequencing27 reads, 12 experiments
Evidence experimental; RT-PCR [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).