Stem-loop sequence hsa-mir-621

AccessionMI0003635 (change log)
Symbol HGNC:MIR621
DescriptionHomo sapiens miR-621 stem-loop
Gene family MIPF0000631; mir-621
Literature search

3 open access papers mention hsa-mir-621
(5 sentences)

Stem-loop
   uagauuga   ---      u   u        g  c     u   cug   aa 
5'         gga   aggggc gag gguaggcg ug ugcug gcu   aug  g
           |||   |||||| ||| |||||||| || ||||| |||   |||   
3'         ccu   ucucug uuu ccauucgc ac acgau cgg   uac  a
   --------   ggg      u   -        g  a     -   -ug   cc 
Get sequence
Deep sequencing
24 reads, 11.8 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 40810766-40810861 [+]
intergenic
Database links

Mature sequence hsa-miR-621

Accession MIMAT0003290
Sequence

61 - 

ggcuagcaacagcgcuuaccu

 - 81

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).