Stem-loop sequence hsa-mir-617

AccessionMI0003631 (change log)
Symbol HGNC:MIR617
DescriptionHomo sapiens miR-617 stem-loop
Gene family MIPF0000672; mir-617
Literature search

9 open access papers mention hsa-mir-617
(17 sentences)

Stem-loop
   ---------------c    u         a     c              ccau 
5'                 auca aaggagccu gacuu ccauuugaaggugg    u
                   |||| ||||||||| ||||| ||||||||||||||     
3'                 uagu uuccucgga cugaa gguaaacuuccacc    u
   cgaggaguaaauaacu    c         c     u              aucc 
Get sequence
Deep sequencing
26 reads, 38.5 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 80832533-80832629 [-]
antisense
OTTHUMT00000407747 ; PTPRQ-004; intron 6
OTTHUMT00000407746 ; PTPRQ-003; intron 9
OTTHUMT00000383997 ; PTPRQ-002; intron 11
ENST00000551573 ; PTPRQ-004; intron 6
ENST00000547376 ; PTPRQ-003; intron 9
ENST00000551042 ; PTPRQ-002; intron 11
Database links

Mature sequence hsa-miR-617

Accession MIMAT0003286
Sequence

16 - 

agacuucccauuugaagguggc

 - 37

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Microarray [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).