Stem-loop sequence hsa-mir-6134

AccessionMI0021279 (change log)
Symbol HGNC:MIR6134
DescriptionHomo sapiens miR-6134 stem-loop
Gene family MIPF0001445; mir-6134
Stem-loop
   ugggccuugaugucaguagggcuca      aac     --      ----uu      g   aaaug 
5'                          guaggg   ugacc  cucuau      ccaccu cau     a
                            ||||||   |||||  ||||||      |||||| |||      
3'                          cgucuc   guugg  gagaug      ggugga gua     a
   ----------------------uuu      aca     uc      uaggau      -   agucg 
Get sequence
Deep sequencing
16589 reads, 38.9 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 28495555-28495663 [-]
intergenic
Database links

Mature sequence hsa-miR-6134

Accession MIMAT0024618
Sequence

71 - 

ugaggugguaggauguaga

 - 89

Get sequence
Deep sequencing16566 reads, 84 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).