Stem-loop sequence hsa-mir-6132

AccessionMI0021277 (change log)
Symbol HGNC:MIR6132
DescriptionHomo sapiens miR-6132 stem-loop
Gene family MIPF0001438; mir-6132
Stem-loop
   -----------------ugcuauugucuuacugcuaca           ga u      ucc 
5'                                       gcagggcuggg  u gcagua   g
                                         |||||||||||  | ||||||    
3'                                       cguccugaccc  g cgucgu   c
   agacccuacgccacuccgaccugauccaucgucguccc           uc u      ugu 
Get sequence
Deep sequencing
106 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 117020211-117020319 [+]
antisense
OTTHUMT00000316696 ; ASZ1-006; intron 8
OTTHUMT00000141913 ; ASZ1-002; intron 8
OTTHUMT00000141915 ; ASZ1-004; intron 8
OTTHUMT00000138907 ; ASZ1-001; intron 9
OTTHUMT00000141914 ; ASZ1-003; intron 9
ENST00000479454 ; ASZ1-006; intron 8
ENST00000465832 ; ASZ1-002; intron 8
ENST00000450714 ; ASZ1-004; intron 8
ENST00000284629 ; ASZ1-001; intron 9
ENST00000463182 ; ASZ1-003; intron 9
Database links

Mature sequence hsa-miR-6132

Accession MIMAT0024616
Sequence

21 - 

agcagggcuggggauugca

 - 39

Get sequence
Deep sequencing56 reads, 22 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).