Stem-loop sequence hsa-mir-6128

AccessionMI0021272 (change log)
Symbol HGNC:MIR6128
DescriptionHomo sapiens miR-6128 stem-loop
Gene family MIPF0001442; mir-6128
Stem-loop
   aagaagcuuguagauuuuucuc   uacuaucua       --ag         -   -      g 
5'                       ccu         gaauuau    gacuucagu cca ugauuu g
                         |||         |||||||    ||||||||| ||| ||||||  
3'                       gga         uuuaaua    cugagguua ggu auuaaa a
   -------------------uaa   --uuaaaag       aaaa         a   c      a 
Get sequence
Deep sequencing
7652 reads, 20.7 reads per million, 92 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 56743873-56743981 [+]
intergenic
Database links

Mature sequence hsa-miR-6128

Accession MIMAT0024611
Sequence

71 - 

acuggaauuggagucaaaa

 - 89

Get sequence
Deep sequencing7637 reads, 89 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).