Stem-loop sequence hsa-mir-6126

AccessionMI0021260 (change log)
Symbol HGNC:MIR6126
DescriptionHomo sapiens miR-6126 stem-loop
Literature search

2 open access papers mention hsa-mir-6126
(2 sentences)

Stem-loop
   agccugugggaaagagaagagca          aa  ccc         
5'                        gggcagggug  gg   ggcggaga 
                          ||||||||||  ||   ||||||| c
3'                        uccgucccac  cc   ccgucuca 
   --------ucgacacaccgggua          ac  cac         
Get sequence
Deep sequencing
572 reads, 68.5 reads per million, 54 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 3485381-3485469 [-]
antisense
OTTHUMT00000437842 ; LA16c-306E5.2-001; intron 2
ENST00000575785 ; NAA60-001; intron 2
Database links

Mature sequence hsa-miR-6126

Accession MIMAT0024599
Sequence

31 - 

gugaaggcccggcggaga

 - 48

Get sequence
Deep sequencing549 reads, 47 experiments
Evidence experimental; microarray [1]
Predicted targets

References

1