Stem-loop sequence hsa-mir-6125

AccessionMI0021259 (change log)
Symbol HGNC:MIR6125
DescriptionHomo sapiens miR-6125 stem-loop
Literature search

1 open access papers mention hsa-mir-6125
(5 sentences)

Stem-loop
      -     gc  g   ccg       ugccacc   -   a      gugg 
5' gcu cuggg  gu ccg   ccgucgc       ucc ccu ccgcua    a
   ||| |||||  || |||   |||||||       ||| ||| ||||||    a
3' ugg gaccc  ca ggu   ggcggcg       agg gga ggcggu    g
      c     -a  -   cua       -------   c   a      agaa 
Get sequence
Deep sequencing
391 reads, 4.95 reads per million, 101 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 62260359-62260454 [+]
antisense
OTTHUMT00000407967 ; FAM19A2-001; intron 2
OTTHUMT00000408077 ; FAM19A2-006; intron 2
OTTHUMT00000408101 ; FAM19A2-016; intron 2
OTTHUMT00000408016 ; FAM19A2-003; intron 3
OTTHUMT00000408100 ; FAM19A2-012; intron 3
OTTHUMT00000408102 ; FAM19A2-015; intron 3
OTTHUMT00000407968 ; FAM19A2-002; intron 5
ENST00000416284 ; FAM19A2-001; intron 2
ENST00000551449 ; FAM19A2-006; intron 2
ENST00000549958 ; FAM19A2-016; intron 2
ENST00000551619 ; FAM19A2-003; intron 3
ENST00000552075 ; FAM19A2-012; intron 3
ENST00000548780 ; FAM19A2-015; intron 3
ENST00000549379 ; FAM19A2-002; intron 5
Database links

Mature sequence hsa-miR-6125

Accession MIMAT0024598
Sequence

60 - 

gcggaaggcggagcggcgga

 - 79

Get sequence
Deep sequencing139 reads, 59 experiments
Evidence experimental; microarray [1]
Database links
Predicted targets

References

1