Stem-loop sequence hsa-mir-612

AccessionMI0003625 (change log)
Symbol HGNC:MIR612
DescriptionHomo sapiens miR-612 stem-loop
Gene family MIPF0000464; mir-612
Literature search

13 open access papers mention hsa-mir-612
(62 sentences)

Stem-loop
   ------   -ca     --a  c  cu   c          -        -a  a 
5'       ucc   ucugg   cc ug  ggg agggcuucug agcuccuu  gc c
         |||   |||||   || ||  ||| |||||||||| ||||||||  ||  
3'       agg   ggacc   gg ac  ccc ucccggggac ucggggag  cg u
   acucuc   aca     gac  u  cu   -          c        ga  a 
Get sequence
Deep sequencing
729 reads, 45.5 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 65444458-65444557 [+]
intergenic
Database links

Mature sequence hsa-miR-612

Accession MIMAT0003280
Sequence

16 - 

gcugggcagggcuucugagcuccuu

 - 40

Get sequence
Deep sequencing706 reads, 28 experiments
Evidence experimental; RT-PCR [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).