Stem-loop sequence hsa-mir-6089-1

AccessionMI0020366 (change log)
Symbol HGNC:MIR6089
DescriptionHomo sapiens miR-6089-1 stem-loop
Gene family MIPF0001510; mir-6089
Literature search

2 open access papers mention hsa-mir-6089-1
(6 sentences)

Stem-loop
       gg    g  guu   u    uu  -g   g 
5' cccc  gccc gc   ccc cccc  cc  ugc c
   ||||  |||| ||   ||| ||||  ||  |||  
3' gggg  cggg cg   ggg gggg  gg  gug c
       --    g  ---   u    cc  ag   a 
Get sequence
Deep sequencing
84 reads, 2.63 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 2609191-2609254 [+]
sense
OTTHUMT00000055624 ; CD99-001; 3'UTR (exon 1)
ENST00000381192 ; CD99-001; 3'UTR (exon 1)
Database links

Mature sequence hsa-miR-6089

Accession MIMAT0023714
Sequence

39 - 

ggaggccgggguggggcggggcgg

 - 62

Get sequence
Deep sequencing134 reads, 30 experiments
Evidence experimental; cloned [1], qPCR [1]
Predicted targets

References

1
PMID:22142236 "Discovery and characterization of novel microRNAs during endothelial differentiation of human embryonic stem cells" Yoo JK, Kim J, Choi SJ, Noh HM, Kwon YD, Yoo H, Yi HS, Chung HM, Kim JK Stem Cells Dev. 21:2049-2057(2012).