Stem-loop sequence hsa-mir-6088

AccessionMI0020365 (change log)
Symbol HGNC:MIR6088
DescriptionHomo sapiens miR-6088 stem-loop
Literature search

2 open access papers mention hsa-mir-6088
(4 sentences)

Stem-loop
   a     ga    ggg    ---    u 
5'  gagau  agcg   gggc   gggg c
    |||||  ||||   ||||   |||| u
3'  cucua  ucgc   uccg   ucuc u
   a     -g    --a    uua    g 
Get sequence
Deep sequencing
3343 reads, 24.7 reads per million, 85 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 45436654-45436704 [+]
intergenic
Database links

Mature sequence hsa-miR-6088

Accession MIMAT0023713
Sequence

1 - 

agagaugaagcgggggggcg

 - 20

Get sequence
Deep sequencing33 reads, 21 experiments
Evidence experimental; cloned [1], qPCR [1]
Predicted targets

References

1
PMID:22142236 "Discovery and characterization of novel microRNAs during endothelial differentiation of human embryonic stem cells" Yoo JK, Kim J, Choi SJ, Noh HM, Kwon YD, Yoo H, Yi HS, Chung HM, Kim JK Stem Cells Dev. 21:2049-2057(2012).