Stem-loop sequence hsa-mir-6086

AccessionMI0020363 (change log)
Symbol HGNC:MIR6086
DescriptionHomo sapiens miR-6086 stem-loop
Stem-loop
         uu   a           gag 
5' aggagg  ggg agggcagagau   c
   ||||||  ||| |||||||||||   a
3' uuuuuc  uuu uuccguuuuug   u
         uu   g           aaa 
Get sequence
Deep sequencing
14 reads, 83.3 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 13590292-13590346 [+]
sense
OTTHUMT00000055800 ; EGFL6-002; intron 1
OTTHUMT00000055801 ; EGFL6-003; intron 1
ENST00000361306 ; EGFL6-002; intron 1
ENST00000380602 ; EGFL6-003; intron 1
Database links

Mature sequence hsa-miR-6086

Accession MIMAT0023711
Sequence

2 - 

ggagguugggaagggcagag

 - 21

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; cloned [1], qPCR [1]
Predicted targets

References

1
PMID:22142236 "Discovery and characterization of novel microRNAs during endothelial differentiation of human embryonic stem cells" Yoo JK, Kim J, Choi SJ, Noh HM, Kwon YD, Yoo H, Yi HS, Chung HM, Kim JK Stem Cells Dev. 21:2049-2057(2012).