Stem-loop sequence hsa-mir-6084

AccessionMI0020361 (change log)
Symbol HGNC:MIR6084
DescriptionHomo sapiens miR-6084 stem-loop
Literature search

1 open access papers mention hsa-mir-6084
(1 sentences)

Stem-loop
   -a     - a    g      ag   cg    c    ccuc  a   u   gcuc  g 
5'   gcguc c ggcu ggccgc  gac  ggcg ggag    gc ggg cgg    gg c
     ||||| | |||| ||||||  |||  |||| ||||    || ||| |||    ||  
3'   cgcgg g ucgg ccggug  cug  ccgc cuuc    cg cuc gcc    cc u
   gg     c g    g      -g   -a    -    --uu  c   u   -aau  c 
Get sequence
Deep sequencing
980 reads, 0 reads per million, 60 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 20633679-20633788 [+]
sense
OTTHUMT00000242830 ; VWA5B1-004; intron 1
OTTHUMT00000007945 ; VWA5B1-001; intron 1
OTTHUMT00000007946 ; VWA5B1-002; intron 1
OTTHUMT00000389807 ; VWA5B1-006; intron 1
OTTHUMT00000389808 ; VWA5B1-007; intron 1
ENST00000485375 ; VWA5B1-004; intron 1
ENST00000375079 ; VWA5B1-001; intron 1
ENST00000473325 ; VWA5B1-002; intron 1
ENST00000530722 ; VWA5B1-006; intron 1
ENST00000534075 ; VWA5B1-007; intron 1
ENST00000289815 ; VWA5B1-201; intron 1
ENST00000375083 ; VWA5B1-203; intron 1
ENST00000289825 ; VWA5B1-202; intron 1
antisense
OTTHUMT00000007948 ; RP4-745E8.2-001; intron 1
ENST00000444923 ; RP4-745E8.2-001; intron 1
Database links

Mature sequence hsa-miR-6084

Accession MIMAT0023709
Sequence

78 - 

uuccgccagucgguggccgg

 - 97

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).