Stem-loop sequence hsa-mir-6083

AccessionMI0020360 (change log)
Symbol HGNC:MIR6083
DescriptionHomo sapiens miR-6083 stem-loop
Stem-loop
   --   aaaa       g     gg  ---   u g     ga  ag  g a  guc 
5'   gua    gagucca agucu  ga   agg g aaagg  gc  ga c uc   u
     |||    ||||||| |||||  ||   ||| | |||||  ||  || | ||    
3'   cau    uucgggu ucgga  cu   uuc c uuucc  ug  cu g ag   u
   ga   --cc       g     ga  aua   u g     -a  ga  g g  aau 
Get sequence
Deep sequencing
45 reads, 6.67 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 124374332-124374437 [+]
sense
OTTHUMT00000356375 ; KALRN-014; intron 2
OTTHUMT00000258840 ; KALRN-002; intron 5
OTTHUMT00000246891 ; KALRN-001; intron 5
OTTHUMT00000258842 ; KALRN-004; intron 37
ENST00000459915 ; KALRN-014; intron 2
ENST00000428018 ; KALRN-202; intron 4
ENST00000393496 ; KALRN-002; intron 5
ENST00000291478 ; KALRN-001; intron 5
ENST00000354186 ; KALRN-004; intron 37
ENST00000360013 ; KALRN-201; intron 38
Database links

Mature sequence hsa-miR-6083

Accession MIMAT0023708
Sequence

77 - 

cuuauaucagaggcuguggg

 - 96

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).