Stem-loop sequence hsa-mir-6081

AccessionMI0020358 (change log)
Symbol HGNC:MIR6081
DescriptionHomo sapiens miR-6081 stem-loop
Stem-loop
   -c     ---c         a  ag    ---u    -  ----      a ac 
5'   cacca    ggugcuggc cc  ggcc    cugc cc    cguagg c  c
     |||||    ||||||||| ||  ||||    |||| ||    |||||| |   
3'   guggu    ccacggccg gg  ccgg    gacg gg    guauuc g  g
   ua     ucua         c  aa    ccgu    a  auaa      - ga 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 95065350-95065446 [+]
antisense
OTTHUMT00000053081 ; NOL8-009; intron 3
OTTHUMT00000402682 ; NOL8-012; intron 10
OTTHUMT00000053082 ; NOL8-010; intron 10
OTTHUMT00000053080 ; NOL8-008; intron 11
OTTHUMT00000053078 ; NOL8-006; intron 12
OTTHUMT00000402684 ; NOL8-015; intron 12
OTTHUMT00000053075 ; NOL8-003; intron 12
OTTHUMT00000402685 ; NOL8-017; intron 12
OTTHUMT00000053076 ; NOL8-004; intron 12
OTTHUMT00000402683 ; NOL8-016; intron 13
ENST00000477862 ; NOL8-009; intron 3
ENST00000545444 ; NOL8-012; intron 10
ENST00000535387 ; NOL8-010; intron 10
ENST00000542053 ; NOL8-008; intron 11
ENST00000442668 ; NOL8-006; intron 12
ENST00000545558 ; NOL8-015; intron 12
ENST00000360868 ; NOL8-003; intron 12
ENST00000544867 ; NOL8-017; intron 12
ENST00000432670 ; NOL8-004; intron 12
ENST00000536593 ; NOL8-016; intron 13
ENST00000358855 ; NOL8-201; intron 13
Database links

Mature sequence hsa-miR-6081

Accession MIMAT0023706
Sequence

57 - 

aggagcagugccggccaaggcgcc

 - 80

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).