Stem-loop sequence hsa-mir-6079

AccessionMI0020356 (change log)
Symbol HGNC:MIR6079
DescriptionHomo sapiens miR-6079 stem-loop
Stem-loop
   uc    ac     ---a   -  gg       a 
5'   cuag  cuagu    uca gu  ccaaaga a
     ||||  |||||    ||| ||  |||||||  
3'   gguc  gauca    ggu cg  gguuuuu c
   uc    --     acca   u  aa       u 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 43838622-43838683 [+]
intergenic
Database links

Mature sequence hsa-miR-6079

Accession MIMAT0023704
Sequence

36 - 

uuggaagcuuggaccaacuagcug

 - 59

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).