Stem-loop sequence hsa-mir-6076

AccessionMI0020353 (change log)
Symbol HGNC:MIR6076
DescriptionHomo sapiens miR-6076 stem-loop
Literature search

1 open access papers mention hsa-mir-6076
(2 sentences)

Stem-loop
   ag  u   ag     a      --   --a   --         auaa uu   -    ag 
5'   ca gac  aggag ggugga  ggu   ggc  gagaguaau    u  cuc cagg  a
     || |||  ||||| ||||||  |||   |||  |||||||||    |  ||| ||||   
3'   gu uug  uccuc ccacuu  ccg   ccg  cuuucguug    g  gag gucu  a
   gg  -   ag     -      uc   guc   uc         --aa gg   a    ac 
Get sequence
Deep sequencing
33 reads, 21.7 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 49966399-49966511 [+]
intergenic
Database links

Mature sequence hsa-miR-6076

Accession MIMAT0023701
Sequence

1 - 

agcaugacagaggagaggugg

 - 21

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).