Stem-loop sequence hsa-mir-6074

AccessionMI0020351 (change log)
Symbol HGNC:MIR6074
DescriptionHomo sapiens miR-6074 stem-loop
Stem-loop
   ---    a    -  u  -a       -   -    uc    aa    uuug    u 
5'    uacc accc ca gg  auuuuua cuc accu  aguc  cuga    cucu u
      |||| |||| || ||  ||||||| ||| ||||  ||||  ||||    |||| g
3'    gugg uggg gu cc  uggagau gag ugga  ucgg  gacu    gagg g
   ggu    g    a  u  ga       a   g    --    -a    uaua    u 
Get sequence
Deep sequencing
14 reads, 50 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 66023620-66023726 [-]
sense
OTTHUMT00000401440 ; RP11-230G5.2-003; intron 1
OTTHUMT00000401441 ; RP11-230G5.2-005; intron 1
OTTHUMT00000401443 ; RP11-230G5.2-008; intron 1
OTTHUMT00000401446 ; RP11-230G5.2-004; intron 1
OTTHUMT00000401447 ; RP11-230G5.2-006; intron 1
OTTHUMT00000401448 ; RP11-230G5.2-007; intron 1
ENST00000537250 ; RP11-230G5.2-003; intron 1
ENST00000535315 ; RP11-230G5.2-005; intron 1
ENST00000539653 ; RP11-230G5.2-008; intron 1
ENST00000546198 ; RP11-230G5.2-004; intron 1
ENST00000537298 ; RP11-230G5.2-006; intron 1
ENST00000544557 ; RP11-230G5.2-007; intron 1
Database links

Mature sequence hsa-miR-6074

Accession MIMAT0023699
Sequence

58 - 

gauauucagaggcuaggugg

 - 77

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).