Stem-loop sequence hsa-mir-6073

AccessionMI0020350 (change log)
Symbol HGNC:MIR6073
DescriptionHomo sapiens miR-6073 stem-loop
Stem-loop
   ---    ug   g  - aa    aa         g     gu    c 
5'    uaga  uug uc c  acug  aguugauga ucacu  gccu u
      ||||  ||| || |  ||||  ||||||||| |||||  ||||  
3'    guuu  gac ag g  ugac  ucgacuauu aguga  uggg c
   ccg    gu   g  a ag    -a         g     --    g 
Get sequence
Deep sequencing
493 reads, 4.08 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 15969533-15969621 [-]
intergenic
Database links

Mature sequence hsa-miR-6073

Accession MIMAT0023698
Sequence

48 - 

gguagugaguuaucagcuac

 - 67

Get sequence
Deep sequencing455 reads, 23 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).