Stem-loop sequence hsa-mir-6072

AccessionMI0020349 (change log)
Symbol HGNC:MIR6072
DescriptionHomo sapiens miR-6072 stem-loop
Stem-loop
   ---   ug g    --       --g      cuuu  u 
5'    ggg  g ggcu  ggugcag   gauggg    gc a
      |||  | ||||  |||||||   ||||||    ||  
3'    ucc  c ucga  ccacguc   cuacuc    cg c
   agg   gu g    uu       aca      --cu  u 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 2076019-2076089 [-]
intergenic
Database links

Mature sequence hsa-miR-6072

Accession MIMAT0023697
Sequence

38 - 

uccucaucacacugcaccuuag

 - 59

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).