Stem-loop sequence hsa-mir-607

AccessionMI0003620 (change log)
Symbol HGNC:MIR607
DescriptionHomo sapiens miR-607 stem-loop
Gene family MIPF0000480; mir-607
Literature search

5 open access papers mention hsa-mir-607
(11 sentences)

Stem-loop
   uug                               g         g  c 
5'    ccuaaagucacacagguuauagaucuggauu gaacccagg ag c
      ||||||||||||||||||||||||||||||| ||||||||| || a
3'    ggguuucaguguguucaauaucuagaccuaa cuugggucc uc g
   ---                               a         g  a 
Get sequence
Deep sequencing
237 reads, 0 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 96828669-96828764 [-]
sense
OTTHUMT00000280388 ; CYP2C8-003; intron 1
OTTHUMT00000049499 ; CYP2C8-001; intron 1
OTTHUMT00000390333 ; CYP2C8-008; intron 1
OTTHUMT00000390334 ; CYP2C8-005; intron 1
OTTHUMT00000390335 ; CYP2C8-006; intron 1
OTTHUMT00000390337 ; CYP2C8-004; intron 1
OTTHUMT00000390338 ; CYP2C8-007; intron 1
OTTHUMT00000049500 ; CYP2C8-002; intron 1
ENST00000527420 ; CYP2C8-003; intron 1
ENST00000371270 ; CYP2C8-001; intron 1
ENST00000490994 ; CYP2C8-008; intron 1
ENST00000526814 ; CYP2C8-005; intron 1
ENST00000527953 ; CYP2C8-006; intron 1
ENST00000533320 ; CYP2C8-004; intron 1
ENST00000525991 ; CYP2C8-007; intron 1
ENST00000479946 ; CYP2C8-002; intron 1
ENST00000535898 ; CYP2C8-201; intron 1
ENST00000539050 ; CYP2C8-202; intron 1
Database links

Mature sequence hsa-miR-607

Accession MIMAT0003275
Sequence

61 - 

guucaaauccagaucuauaac

 - 81

Get sequence
Deep sequencing14 reads, 12 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).