Stem-loop sequence hsa-mir-6069

AccessionMI0020346 (change log)
Symbol HGNC:MIR6069
DescriptionHomo sapiens miR-6069 stem-loop
Literature search

3 open access papers mention hsa-mir-6069
(13 sentences)

Stem-loop
   ---   u    -      cuag     g ug   -     c 
5'    ugg gacc ccuggg    ggccu c  ccc ccugc c
      ||| |||| ||||||    ||||| |  ||| ||||| a
3'    acc cugg ggauuc    cuggg g  ggg ggacg g
   gug   -    u      cuca     a gu   a     u 
Get sequence
Deep sequencing
14 reads, 244 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 35336721-35336799 [-]
sense
OTTHUMT00000467276 ; RP1-272J12.1-003; intron 8
ENST00000448318 ; RP1-272J12.1-003; intron 8
Clustered miRNAs
< 10kb from hsa-mir-6069
hsa-mir-6069chr22: 35336721-35336799 [-]
hsa-mir-3909chr22: 35335640-35335758 [+]
Database links

Mature sequence hsa-miR-6069

Accession MIMAT0023694
Sequence

12 - 

gggcuagggccugcugccccc

 - 32

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).