Stem-loop sequence hsa-mir-603

AccessionMI0003616 (change log)
Symbol HGNC:MIR603
DescriptionHomo sapiens miR-603 stem-loop
Gene family MIPF0000317; mir-548
Literature search

16 open access papers mention hsa-mir-603
(240 sentences)

Stem-loop
   gauugaugc      u    u                  cuuc     ua 
5'          uguugg uugg gcaaaaguaauugcagug    ccauu  a
            |||||| |||| ||||||||||||||||||    |||||  a
3'          auaauu aacc cguuuucauuaacgucac    gguaa  a
   ------uuc      c    u                  acac     ug 
Get sequence
Deep sequencing
778 reads, 1.41 reads per million, 71 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 24275685-24275781 [+]
sense
OTTHUMT00000047221 ; KIAA1217-002; intron 1
ENST00000376462 ; KIAA1217-002; intron 1
Database links

Mature sequence hsa-miR-603

Accession MIMAT0003271
Sequence

61 - 

cacacacugcaauuacuuuugc

 - 82

Get sequence
Deep sequencing83 reads, 43 experiments
Evidence experimental; Microarray [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).