Stem-loop sequence hsa-mir-602

AccessionMI0003615 (change log)
Symbol HGNC:MIR602
DescriptionHomo sapiens miR-602 stem-loop
Gene family MIPF0000767; mir-602
Literature search

13 open access papers mention hsa-mir-602
(23 sentences)

Stem-loop
   -----------uu   a   cc        c   c   -a   g       cu  g 
5'              cuc ccc  gccugaca ggg gac  gcu cggcccg  gu u
                ||| |||  |||||||| ||| |||  ||| |||||||  ||  
3'              gag ggg  cggacugu ccu cug  uga gccgggc  ca u
   guccccccgagac   a   aa        -   -   cg   -       -u  c 
Get sequence
Deep sequencing
48 reads, 4.17 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 137838419-137838516 [+]
intergenic
Database links

Mature sequence hsa-miR-602

Accession MIMAT0003270
Sequence

16 - 

gacacgggcgacagcugcggccc

 - 38

Get sequence
Deep sequencing29 reads, 13 experiments
Evidence experimental; Microarray [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).