Stem-loop sequence hsa-mir-600

AccessionMI0003613 (change log)
Symbol HGNC:MIR600
DescriptionHomo sapiens miR-600 stem-loop
Gene family MIPF0000484; mir-600
Literature search

10 open access papers mention hsa-mir-600
(16 sentences)

Stem-loop
   aagucacgu  u u    cca    cau  g               c  gcagu 
5'          gc g ggcu   gcuu   ag aaggcucuugucugu ag     g
            || | ||||   ||||   || ||||||||||||||| ||      
3'          cg c ccga   cgga   uc uuccgagaacagaca uc     g
   -------cc  u -    --c    --c  g               u  auuga 
Get sequence
Deep sequencing
136 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 123111546-123111643 [-]
intergenic
Database links

Mature sequence hsa-miR-600

Accession MIMAT0003268
Sequence

61 - 

acuuacagacaagagccuugcuc

 - 83

Get sequence
Deep sequencing29 reads, 18 experiments
Evidence experimental; RT-PCR [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).