Stem-loop sequence hsa-mir-591

AccessionMI0003603 (change log)
Symbol HGNC:MIR591
DescriptionHomo sapiens miR-591 stem-loop
Gene family MIPF0000641; mir-591
Literature search

2 open access papers mention hsa-mir-591
(2 sentences)

Stem-loop
   ----ucuuaucaa    gu   -   u  -    u  uug    ---a  g 
5'              ugag  aga cca gg guuc ca   uaau    gu u
                ||||  ||| ||| || |||| ||   ||||    || a
3'              acuc  ucu ggu cc cagg gu   auug    ua g
   cuuagucaucuaa    ug   c   c  u    u  -ca    guug  a 
Get sequence
Deep sequencing
65 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 96219662-96219756 [-]
sense
OTTHUMT00000319594 ; SHFM1-002; intron 2
ENST00000466986 ; SHFM1-002; intron 2
Database links

Mature sequence hsa-miR-591

Accession MIMAT0003259
Sequence

16 - 

agaccauggguucucauugu

 - 35

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).