Stem-loop sequence hsa-mir-587

AccessionMI0003595 (change log)
Symbol HGNC:MIR587
DescriptionHomo sapiens miR-587 stem-loop
Gene family MIPF0000563; mir-587
Literature search

1 open access papers mention hsa-mir-587
(1 sentences)

Stem-loop
   cucc    -cacccu        a                gcu    ga 
5'     uaug       cuuuccau ggugaugagucacagg   cagg  a
       ||||       |||||||| ||||||||||||||||   ||||  u
3'     auac       gaaaggug ccacuacucagugucc   gucu  g
   ---u    ccuaccc        a                -ac    gu 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 106784125-106784220 [+]
intergenic
Database links

Mature sequence hsa-miR-587

Accession MIMAT0003253
Sequence

16 - 

uuuccauaggugaugagucac

 - 36

Get sequence
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).