Stem-loop sequence hsa-mir-586

AccessionMI0003594 (change log)
Symbol HGNC:MIR586
DescriptionHomo sapiens miR-586 stem-loop
Gene family MIPF0000467; mir-586
Literature search

6 open access papers mention hsa-mir-586
(8 sentences)

Stem-loop
   ----------au     --                           u    au 
5'             ggggu  aaaaccauuaugcauuguauuuuuagg ccca  a
               |||||  ||||||||||||||||||||||||||| ||||  c
3'             ucuca  uuuugguaauacguaacauaaaaaucc gggu  a
   uauucuucuauu     cu                           c    gu 
Get sequence
Deep sequencing
58 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 45197674-45197770 [-]
sense
OTTHUMT00000040749 ; SUPT3H-001; intron 2
OTTHUMT00000106911 ; SUPT3H-006; intron 2
OTTHUMT00000106910 ; SUPT3H-005; intron 4
ENST00000306867 ; SUPT3H-201; intron 1
ENST00000475057 ; SUPT3H-001; intron 2
ENST00000371459 ; SUPT3H-006; intron 2
ENST00000371461 ; SUPT3H-202; intron 2
ENST00000371460 ; SUPT3H-005; intron 4
Database links

Mature sequence hsa-miR-586

Accession MIMAT0003252
Sequence

16 - 

uaugcauuguauuuuuaggucc

 - 37

Get sequence
Deep sequencing36 reads, 13 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).