Stem-loop sequence hsa-mir-585

AccessionMI0003592 (change log)
Symbol HGNC:MIR585
DescriptionHomo sapiens miR-585 stem-loop
Literature search

3 open access papers mention hsa-mir-585
(3 sentences)

Stem-loop
   uggggugucug  c                c              a aaag 
5'            ug uauggcagcccuagca acagauacgcccag g    c
              || |||||||||||||||| |||||||||||||| |     
3'            ac augucgucgggaucgu ugucuaugcggguu c    c
   ----------a  a                a              g aagu 
Get sequence
Deep sequencing
3341 reads, 5.69 reads per million, 123 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 169263601-169263694 [-]
antisense
OTTHUMT00000376201 ; DOCK2-016; intron 2
OTTHUMT00000371654 ; DOCK2-015; intron 3
OTTHUMT00000376238 ; DOCK2-017; intron 4
OTTHUMT00000371653 ; DOCK2-014; intron 5
OTTHUMT00000371643 ; DOCK2-004; intron 12
OTTHUMT00000252828 ; DOCK2-001; intron 26
OTTHUMT00000371641 ; DOCK2-002; intron 26
ENST00000523351 ; DOCK2-016; intron 2
ENST00000519628 ; DOCK2-015; intron 3
ENST00000520181 ; DOCK2-017; intron 4
ENST00000520836 ; DOCK2-014; intron 5
ENST00000520908 ; DOCK2-004; intron 12
ENST00000540750 ; DOCK2-201; intron 12
ENST00000256935 ; DOCK2-001; intron 26
ENST00000524185 ; DOCK2-002; intron 26
Database links

Mature sequence hsa-miR-585-5p

Accession MIMAT0026618
Sequence

25 - 

cuagcacacagauacgcccaga

 - 46

Get sequence
Deep sequencing202 reads, 61 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence hsa-miR-585-3p

Accession MIMAT0003250
Sequence

61 - 

ugggcguaucuguaugcua

 - 79

Get sequence
Deep sequencing3128 reads, 122 experiments
Evidence experimental; SAGE [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).