Stem-loop sequence hsa-mir-580

AccessionMI0003587 (change log)
Symbol HGNC:MIR580
DescriptionHomo sapiens miR-580 stem-loop
Gene family MIPF0000515; mir-580
Literature search

9 open access papers mention hsa-mir-580
(44 sentences)

Stem-loop
   auaa      ca                      ga          uaa 
5'     aauuuc  auuggaaccuaaugauucauca  cucagauauu   g
       ||||||  ||||||||||||||||||||||  ||||||||||   u
3'     uuaaag  uggccuuggauuacuaaguagu  gaguuuauga   u
   ----      ac                      aa          caa 
Get sequence
Deep sequencing
450 reads, 0 reads per million, 97 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 36147892-36147988 [-]
sense
OTTHUMT00000367552 ; LMBRD2-001; intron 1
ENST00000296603 ; LMBRD2-001; intron 1
Database links

Mature sequence hsa-miR-580-5p

Accession MIMAT0026617
Sequence

22 - 

uaaugauucaucagacucagau

 - 43

Get sequence
Deep sequencing19 reads, 15 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-580-3p

Accession MIMAT0003245
Sequence

61 - 

uugagaaugaugaaucauuagg

 - 82

Get sequence
Deep sequencing431 reads, 93 experiments
Evidence experimental; RT-PCR [1], SAGE [1], Illumina [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).