Stem-loop sequence hsa-mir-5787

AccessionMI0019797 (change log)
Symbol HGNC:MIR5787
DescriptionHomo sapiens miR-5787 stem-loop
Literature search

2 open access papers mention hsa-mir-5787
(3 sentences)

Stem-loop
   g    c  g         aggu   -   u 
5'  gggg ug ggcgcgggg    gcu agg c
    |||| || |||||||||    ||| |||  
3'  cccc ac ccgcgcccu    cgg ucc g
   -    -  g         ----   c   g 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 50227436-50227490 [+]
intergenic
Database links

Mature sequence hsa-miR-5787

Accession MIMAT0023252
Sequence

3 - 

gggcuggggcgcggggaggu

 - 22

Get sequence
Deep sequencing8 reads, 7 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:22062548 "The hsa-miR-5787 represses cellular growth by targeting eukaryotic translation initiation factor 5 (eIF5) in fibroblasts" Yoo H, Yoo JK, Lee J, Lee DR, Ko JJ, Oh SH, Choo YK, Kim JK Biochem Biophys Res Commun. 415:567-572(2011).