Stem-loop sequence hsa-mir-577

AccessionMI0003584 (change log)
Symbol HGNC:MIR577
DescriptionHomo sapiens miR-577 stem-loop
Gene family MIPF0000530; mir-577
Literature search

13 open access papers mention hsa-mir-577
(29 sentences)

Stem-loop
   -----------                       a      u     augaa 
5'            ugggggagugaagaguagauaaa uauugg accug     u
              ||||||||||||||||||||||| |||||| |||||     c
3'            accccuuuacuucucgucuauuu auaacu uggac     u
   cauucaucuau                       c      u     cggag 
Get sequence
Deep sequencing
7598 reads, 13.3 reads per million, 105 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 114656759-114656854 [+]
antisense
OTTHUMT00000256418 ; CAMK2D-001; intron 2
OTTHUMT00000365323 ; CAMK2D-008; intron 2
OTTHUMT00000256420 ; CAMK2D-003; intron 2
OTTHUMT00000365324 ; CAMK2D-009; intron 2
OTTHUMT00000365327 ; CAMK2D-012; intron 2
OTTHUMT00000365319 ; CAMK2D-004; intron 2
OTTHUMT00000365320 ; CAMK2D-005; intron 2
OTTHUMT00000256419 ; CAMK2D-002; intron 2
OTTHUMT00000365321 ; CAMK2D-006; intron 2
ENST00000394524 ; CAMK2D-001; intron 2
ENST00000511664 ; CAMK2D-008; intron 2
ENST00000342666 ; CAMK2D-003; intron 2
ENST00000515496 ; CAMK2D-009; intron 2
ENST00000514328 ; CAMK2D-012; intron 2
ENST00000394522 ; CAMK2D-004; intron 2
ENST00000505990 ; CAMK2D-005; intron 2
ENST00000379773 ; CAMK2D-002; intron 2
ENST00000508738 ; CAMK2D-006; intron 2
ENST00000454265 ; CAMK2D-205; intron 2
ENST00000429180 ; CAMK2D-204; intron 2
ENST00000418639 ; CAMK2D-203; intron 2
ENST00000394526 ; CAMK2D-202; intron 2
ENST00000296402 ; CAMK2D-201; intron 2
Database links

Mature sequence hsa-miR-577

Accession MIMAT0003242
Sequence

16 - 

uagauaaaauauugguaccug

 - 36

Get sequence
Deep sequencing7430 reads, 103 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).