Stem-loop sequence hsa-mir-576

AccessionMI0003583 (change log)
Symbol HGNC:MIR576
DescriptionHomo sapiens miR-576 stem-loop
Gene family MIPF0000493; mir-576
Literature search

21 open access papers mention hsa-mir-576
(83 sentences)

Stem-loop
   --------ua     c  c              c            g   ua 
5'           caauc aa gaggauucuaauuu uccacgucuuug uaa  a
             ||||| || |||||||||||||| |||||||||||| |||   
3'           guuag uu cuccuaagguuaaa agguguagaaac guu  g
   accaauauug     c  a              a            g   ug 
Get sequence
Deep sequencing
15120 reads, 15.9 reads per million, 157 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 109488698-109488795 [+]
antisense
OTTHUMT00000363481 ; RP11-462C24.1-001; intron 1
OTTHUMT00000363482 ; RP11-462C24.1-002; intron 1
OTTHUMT00000363483 ; RP11-462C24.1-003; intron 2
ENST00000507248 ; RPL34-AS1-001; intron 1
ENST00000506795 ; RPL34-AS1-002; intron 1
ENST00000509984 ; RPL34-AS1-003; intron 2
Database links

Mature sequence hsa-miR-576-5p

Accession MIMAT0003241
Previous IDshsa-miR-576
Sequence

16 - 

auucuaauuucuccacgucuuu

 - 37

Get sequence
Deep sequencing7538 reads, 151 experiments
Evidence experimental; SAGE [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-576-3p

Accession MIMAT0004796
Sequence

55 - 

aagauguggaaaaauuggaauc

 - 76

Get sequence
Deep sequencing7254 reads, 150 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).