Stem-loop sequence hsa-mir-5739

AccessionMI0019412 (change log)
Symbol HGNC:MIR5739
DescriptionHomo sapiens miR-5739 stem-loop
Literature search

1 open access papers mention hsa-mir-5739
(2 sentences)

Stem-loop
   gg      auaa    - -a     -a   uugu   uu  g 
5'   uuggcu    cuau c  uuucc  agg    gcu  ua g
     ||||||    |||| |  |||||  |||    |||  || a
3'   gaccga    ggua g  agagg  ucc    cgg  gu a
   -g      --gg    a ag     cg   -ugu   uu  a 
Get sequence
Deep sequencing
12 reads, 50 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 28459869-28459948 [+]
antisense
OTTHUMT00000320932 ; TTC28-003; intron 1
OTTHUMT00000320930 ; TTC28-001; intron 12
ENST00000442232 ; TTC28-003; intron 1
ENST00000397906 ; TTC28-001; intron 12
Database links

Mature sequence hsa-miR-5739

Accession MIMAT0023116
Sequence

57 - 

gcggagagagaauggggagc

 - 76

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:22020071 "The hsa-miR-5739 modulates the endoglin network in endothelial cells derived from human embryonic stem cells" Yoo JK, Kim J, Choi SJ, Kim CH, Lee DR, Chung HM, Kim JK Biochem Biophys Res Commun. 415:258-262(2011).