Stem-loop sequence hsa-mir-571

AccessionMI0003578 (change log)
Symbol HGNC:MIR571
DescriptionHomo sapiens miR-571 stem-loop
Gene family MIPF0000757; mir-571
Literature search

7 open access papers mention hsa-mir-571
(58 sentences)

Stem-loop
   ccuc      ----a  aa      -  u    u   -cuu        cc 
5'     aguaag     cc  gcucag ug gcca uuc    gucuguag  a
       ||||||     ||  |||||| || |||| |||    ||||||||   
3'     uuauuc     gg  ugaguc ac cggu gag    cggguauc  u
   -auc      guccg  ag      u  -    u   uucu        ug 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 350157-350252 [+]
sense
OTTHUMT00000357715 ; ZNF141-006; intron 1
OTTHUMT00000357711 ; ZNF141-002; intron 3
OTTHUMT00000357712 ; ZNF141-003; intron 3
OTTHUMT00000357714 ; ZNF141-005; intron 3
OTTHUMT00000357710 ; ZNF141-001; intron 3
ENST00000366506 ; ZNF141-006; intron 1
ENST00000512994 ; ZNF141-002; intron 3
ENST00000503699 ; ZNF141-003; intron 3
ENST00000505939 ; ZNF141-005; intron 3
ENST00000240499 ; ZNF141-001; intron 3
Database links

Mature sequence hsa-miR-571

Accession MIMAT0003236
Sequence

61 - 

ugaguuggccaucugagugag

 - 81

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; RT-PCR [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).