Stem-loop sequence hsa-mir-5708

AccessionMI0019316 (change log)
Symbol HGNC:MIR5708
DescriptionHomo sapiens miR-5708 stem-loop
Gene family MIPF0001025; mir-1972
Stem-loop
          a       g          a    aagucaacau 
5' auuacag caugagc acugugccug ccaa          u
   ||||||| ||||||| |||||||||| ||||          a
3' uaauguc guacucg ugacacggac gguu          a
          c       g          c    cuaaacaaca 
Get sequence
Deep sequencing
922 reads, 55.6 reads per million, 126 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 80241389-80241473 [+]
intergenic
Database links

Mature sequence hsa-miR-5708

Accession MIMAT0022502
Sequence

10 - 

augagcgacugugccugacc

 - 29

Get sequence
Deep sequencing60 reads, 38 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).