Stem-loop sequence hsa-mir-5707

AccessionMI0019315 (change log)
Symbol HGNC:MIR5707
DescriptionHomo sapiens miR-5707 stem-loop
Stem-loop
          a  c       u        --a  c   u   u 
5' uguaaga ca guuugaa gcuguaca   gg aca aug g
   ||||||| || ||||||| ||||||||   || ||| |||  
3' auauucu gu caaacuu cgacaugu   cc ugu uac a
          c  a       u        aca  a   -   a 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 158591616-158591696 [+]
antisense
OTTHUMT00000322647 ; ESYT2-001; intron 2
OTTHUMT00000322650 ; ESYT2-004; intron 2
OTTHUMT00000322654 ; ESYT2-008; intron 2
OTTHUMT00000322653 ; ESYT2-007; intron 2
ENST00000251527 ; ESYT2-001; intron 2
ENST00000275418 ; ESYT2-004; intron 2
ENST00000483958 ; ESYT2-008; intron 2
ENST00000497111 ; ESYT2-007; intron 2
Database links

Mature sequence hsa-miR-5707

Accession MIMAT0022501
Sequence

10 - 

acguuugaaugcuguacaaggc

 - 31

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).