Stem-loop sequence hsa-mir-5706

AccessionMI0019314 (change log)
Symbol HGNC:MIR5706
DescriptionHomo sapiens miR-5706 stem-loop
Literature search

1 open access papers mention hsa-mir-5706
(1 sentences)

Stem-loop
                   u             uucua guc 
5' agcuaggucuucugga aacaugcugaagc     c   a
   |||||||||||||||| |||||||||||||     |    
3' ucgaucuaggagaccu uuguacgacuucg     g   u
                   u             uucac acu 
Get sequence
Deep sequencing
99 reads, 0 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 119154637-119154716 [+]
intergenic
Database links

Mature sequence hsa-miR-5706

Accession MIMAT0022500
Sequence

10 - 

uucuggauaacaugcugaagcu

 - 31

Get sequence
Deep sequencing91 reads, 51 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).