Stem-loop sequence hsa-mir-5705

AccessionMI0019313 (change log)
Symbol HGNC:MIR5705
DescriptionHomo sapiens miR-5705 stem-loop
Stem-loop
                                          cc  g 
5' uccccauuuacacaggccaugagccccgaaacacccauc  ag a
   |||||||||||||||||||||||||||||||||||||||  || u
3' agggguaaauguguccgguacucggggcuuuguggguag  uc u
                                          --  g 
Get sequence
Deep sequencing
46 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 87300495-87300583 [-]
sense
OTTHUMT00000253056 ; MAPK10-003; intron 1
OTTHUMT00000253058 ; MAPK10-005; intron 1
OTTHUMT00000361718 ; MAPK10-018; intron 1
OTTHUMT00000361717 ; MAPK10-017; intron 1
OTTHUMT00000361731 ; MAPK10-031; intron 1
OTTHUMT00000361719 ; MAPK10-019; intron 1
OTTHUMT00000361713 ; MAPK10-013; intron 2
OTTHUMT00000361721 ; MAPK10-021; intron 2
OTTHUMT00000361720 ; MAPK10-020; intron 3
ENST00000310816 ; MAPK10-003; intron 1
ENST00000361569 ; MAPK10-005; intron 1
ENST00000502302 ; MAPK10-018; intron 1
ENST00000513186 ; MAPK10-017; intron 1
ENST00000504397 ; MAPK10-031; intron 1
ENST00000512046 ; MAPK10-019; intron 1
ENST00000513839 ; MAPK10-013; intron 2
ENST00000511328 ; MAPK10-021; intron 2
ENST00000503911 ; MAPK10-020; intron 3
Database links

Mature sequence hsa-miR-5705

Accession MIMAT0022499
Sequence

57 - 

uguuucggggcucauggccugug

 - 79

Get sequence
Deep sequencing26 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).