Stem-loop sequence hsa-mir-5704

AccessionMI0019312 (change log)
Symbol HGNC:MIR5704
DescriptionHomo sapiens miR-5704 stem-loop
Stem-loop
   u a                    ca     cuaa   c 
5'  g ucuuguuuaggccaucaucc  uuaug    guc a
    | ||||||||||||||||||||  |||||    |||  
3'  c agaacaaauccgguaguagg  aauac    cgg u
   a c                    ac     -aaa   g 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 26 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 131985855-131985931 [-]
sense
OTTHUMT00000356583 ; CPNE4-001; intron 2
ENST00000512055 ; CPNE4-001; intron 2
Database links

Mature sequence hsa-miR-5704

Accession MIMAT0022498
Sequence

10 - 

uuaggccaucaucccauuaugc

 - 31

Get sequence
Deep sequencing24 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).