Stem-loop sequence hsa-mir-5702

AccessionMI0019309 (change log)
Symbol HGNC:MIR5702
DescriptionHomo sapiens miR-5702 stem-loop
Stem-loop
      u   --c  c                uc       aaau 
5' gcc caa   uc ugggauauguugcuga  caaccug    c
   ||| |||   || ||||||||||||||||  |||||||    c
3' ugg guu   ag acccuauacaacgacu  guuggau    u
      -   uuc  u                ga       gucu 
Get sequence
Deep sequencing
77 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 226658710-226658793 [-]
intergenic
Database links

Mature sequence hsa-miR-5702

Accession MIMAT0022495
Sequence

53 - 

ugagucagcaacauaucccaug

 - 74

Get sequence
Deep sequencing64 reads, 34 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).