Stem-loop sequence hsa-mir-5700

AccessionMI0019307 (change log)
Symbol HGNC:MIR5700
DescriptionHomo sapiens miR-5700 stem-loop
Stem-loop
        u                       cu      
5' uuaau aaugcauuaaauuauugaaggcc  ugggc 
   ||||| |||||||||||||||||||||||  |||| a
3' aguua uuacguaauuuaauaacuuccgg  acccc 
        u                       --      
Get sequence
Deep sequencing
9 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 94561789-94561859 [+]
sense
OTTHUMT00000408126 ; PLXNC1-001; intron 1
OTTHUMT00000408137 ; PLXNC1-011; intron 1
OTTHUMT00000408132 ; PLXNC1-006; intron 1
ENST00000258526 ; PLXNC1-001; intron 1
ENST00000546733 ; PLXNC1-011; intron 1
ENST00000551850 ; PLXNC1-006; intron 1
antisense
OTTHUMT00000408139 ; RP11-74K11.2-002; exon 2
OTTHUMT00000408140 ; RP11-74K11.2-001; exon 2
ENST00000551029 ; RP11-74K11.2-002; exon 2
ENST00000550759 ; RP11-74K11.2-001; exon 2
Clustered miRNAs
< 10kb from hsa-mir-5700
hsa-mir-5700chr12: 94561789-94561859 [+]
hsa-mir-7844chr12: 94571231-94571352 [-]
Database links

Mature sequence hsa-miR-5700

Accession MIMAT0022493
Sequence

6 - 

uaaugcauuaaauuauugaagg

 - 27

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).