Stem-loop sequence hsa-mir-5699

AccessionMI0019306 (change log)
Symbol HGNC:MIR5699
DescriptionHomo sapiens miR-5699 stem-loop
Stem-loop
        c      c                a     gu a  cac 
5' cugua cccugc ccaacaaggaaggaca gaggu  g gc   a
   ||||| |||||| |||||||||||||||| |||||  | ||   c
3' gaugu gggacg gguuguuccuuucugu cuccg  c cg   a
        a      a                c     gu -  cac 
Get sequence
Deep sequencing
1932 reads, 6.15 reads per million, 130 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 641689-641778 [-]
sense
OTTHUMT00000046389 ; DIP2C-001; intron 1
OTTHUMT00000046390 ; DIP2C-002; intron 1
ENST00000280886 ; DIP2C-001; intron 1
ENST00000423550 ; DIP2C-002; intron 1
Database links

Mature sequence hsa-miR-5699-5p

Accession MIMAT0027103
Sequence

10 - 

ugccccaacaaggaaggacaag

 - 31

Get sequence
Deep sequencing1391 reads, 106 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence hsa-miR-5699-3p

Accession MIMAT0022492
Sequence

59 - 

uccugucuuuccuuguuggagc

 - 80

Get sequence
Deep sequencing497 reads, 78 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).