Stem-loop sequence hsa-mir-5698

AccessionMI0019305 (change log)
Symbol HGNC:MIR5698
DescriptionHomo sapiens miR-5698 stem-loop
Literature search

1 open access papers mention hsa-mir-5698
(1 sentences)

Stem-loop
                 g                a  g 
5' cugugcaccugggg agugcagugauugugg au c
   |||||||||||||| |||||||||||||||| || a
3' gacacguggacccc ucaugucacuaacacc ug a
                 -                c  a 
Get sequence
Deep sequencing
196 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 154104521-154104592 [-]
sense
OTTHUMT00000087270 ; NUP210L-001; intron 7
ENST00000368559 ; NUP210L-001; intron 7
ENST00000271854 ; NUP210L-201; intron 7
Database links

Mature sequence hsa-miR-5698

Accession MIMAT0022491
Sequence

10 - 

ugggggagugcagugauugugg

 - 31

Get sequence
Deep sequencing185 reads, 37 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).