Stem-loop sequence hsa-mir-5697

AccessionMI0019304
Symbol HGNC:MIR5697
DescriptionHomo sapiens miR-5697 stem-loop
Gene family MIPF0001748; mir-5697
Stem-loop
      a           a                 gua   g 
5' agc uauucucaagu guuucaugauaaagggu   uga a
   ||| ||||||||||| |||||||||||||||||   |||  
3' ucg auaggaguucg caaaguacuauuuccca   acu g
      c           -                 ---   a 
Get sequence
Deep sequencing
19 reads, 7.84 reads per million, 10 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr1: 9967381-9967458 [+]
antisense
OTTHUMT00000005012 ; CTNNBIP1-001; intron 1
OTTHUMT00000005013 ; CTNNBIP1-002; intron 1
ENST00000377263 ; CTNNBIP1-001; intron 1
ENST00000400904 ; CTNNBIP1-002; intron 1
Database links

Mature sequence hsa-miR-5697

Accession MIMAT0022490
Sequence

10 - 

ucaaguaguuucaugauaaagg

 - 31

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).