Stem-loop sequence hsa-mir-5696

AccessionMI0019303 (change log)
Symbol HGNC:MIR5696
DescriptionHomo sapiens miR-5696 stem-loop
Stem-loop
              a               cuacu     -   aca 
5' gugcucauuua guagucugaugccua     gauga cau   a
   ||||||||||| |||||||||||||||     ||||| |||   u
3' cacgaguaaau caucagacugcggau     uuacu gug   g
              c               -----     c   aau 
Get sequence
Deep sequencing
244 reads, 0 reads per million, 89 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 101309450-101309534 [+]
intergenic
Database links

Mature sequence hsa-miR-5696

Accession MIMAT0022489
Sequence

4 - 

cucauuuaaguagucugaugcc

 - 25

Get sequence
Deep sequencing87 reads, 55 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).