Stem-loop sequence hsa-mir-5695

AccessionMI0019302 (change log)
Symbol HGNC:MIR5695
DescriptionHomo sapiens miR-5695 stem-loop
Stem-loop
               a                cc    -u   ca 
5' caaggccuaucu ucuagauucuucuugg  ucuc  gag  u
   |||||||||||| ||||||||||||||||  ||||  |||   
3' guuccggauaga agaucuaagaagaacc  agag  cuu  g
               c                uc    uc   ac 
Get sequence
Deep sequencing
435 reads, 1.05 reads per million, 95 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 12920320-12920404 [+]
sense
OTTHUMT00000451508 ; RNASEH2A-002; intron 2
OTTHUMT00000451507 ; RNASEH2A-001; intron 4
ENST00000593017 ; RNASEH2A-002; intron 2
ENST00000221486 ; RNASEH2A-001; intron 4
antisense
OTTHUMT00000451500 ; HOOK2-024; intron 3
ENST00000589765 ; HOOK2-024; intron 3
Database links

Mature sequence hsa-miR-5695

Accession MIMAT0022488
Sequence

54 - 

acuccaagaagaaucuagacag

 - 75

Get sequence
Deep sequencing105 reads, 56 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).