Stem-loop sequence hsa-mir-5694

AccessionMI0019301 (change log)
Symbol HGNC:MIR5694
DescriptionHomo sapiens miR-5694 stem-loop
Stem-loop
        c   a            g        -c  uau 
5' gccaa ugc gaucaugggacu ucucagcc  ca   g
   ||||| ||| |||||||||||| ||||||||  ||    
3' cgguu acg cuaguacccuga agagucgg  gu   u
        c   c            -        aa  cua 
Get sequence
Deep sequencing
63 reads, 2.7 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 67441855-67441930 [-]
antisense
OTTHUMT00000412382 ; GPHN-014; intron 5
OTTHUMT00000412215 ; GPHN-008; intron 7
OTTHUMT00000074299 ; GPHN-003; intron 8
OTTHUMT00000286408 ; GPHN-006; intron 9
OTTHUMT00000074298 ; GPHN-004; intron 9
OTTHUMT00000412213 ; GPHN-007; intron 9
ENST00000555456 ; GPHN-014; intron 5
ENST00000544752 ; GPHN-008; intron 7
ENST00000305960 ; GPHN-201; intron 7
ENST00000315266 ; GPHN-003; intron 8
ENST00000478722 ; GPHN-006; intron 9
ENST00000459628 ; GPHN-004; intron 9
ENST00000543237 ; GPHN-007; intron 9
Database links

Mature sequence hsa-miR-5694

Accession MIMAT0022487
Sequence

9 - 

cagaucaugggacugucucag

 - 29

Get sequence
Deep sequencing14 reads, 14 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).