Stem-loop sequence hsa-mir-5693

AccessionMI0019300 (change log)
Symbol HGNC:MIR5693
DescriptionHomo sapiens miR-5693 stem-loop
Literature search

1 open access papers mention hsa-mir-5693
(1 sentences)

Stem-loop
       ga    --            -u   -     u ag 
5' cugg  aguu  aguucauuucag  cug ugcug g  c
   ||||  ||||  ||||||||||||  ||| ||||| |   
3' gauc  ucaa  ucaaguaaaguc  ggu acgac c  u
       --    ac            uc   g     - ga 
Get sequence
Deep sequencing
38 reads, 4.35 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 51348567-51348639 [-]
sense
OTTHUMT00000361815 ; DLEU7-002; intron 1
ENST00000400393 ; DLEU7-002; intron 1
Database links

Mature sequence hsa-miR-5693

Accession MIMAT0022486
Sequence

43 - 

gcaguggcucugaaaugaacuc

 - 64

Get sequence
Deep sequencing15 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).