Stem-loop sequence hsa-mir-5692c-1

AccessionMI0019288 (change log)
Symbol HGNC:MIR5692C1
DescriptionHomo sapiens miR-5692c-1 stem-loop
Gene family MIPF0001351; mir-5692
Stem-loop
              a      c            aga         c 
5' uauaacauugu uauacc acugugauauua   guaauagcu u
   ||||||||||| |||||| ||||||||||||   ||||||||| c
3' auguuguaaca augugg ugacacuauaau   uauuauugg u
              c      a            aag         a 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 135802985-135803075 [-]
antisense
OTTHUMT00000372127 ; RP11-114H21.2-002; intron 1
OTTHUMT00000372126 ; RP11-114H21.2-001; intron 1
ENST00000511165 ; RP11-114H21.2-002; intron 1
ENST00000446720 ; RP11-114H21.2-001; intron 1
Database links

Mature sequence hsa-miR-5692c

Accession MIMAT0022476
Sequence

59 - 

aauaauaucacaguagguguac

 - 80

Get sequence
Deep sequencing46 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).